Aligner tests
You know what I'd kill for? A simple set of tests for each aligner available. I have no idea why we didn't do this ages ago. I'm sick of off-by-one errors caused by all sorts of slightly different formats available - and I can't do unit tests without a good simple demonstration file for each aligner type.
I know Sam format should help with this - assuming everyone adopts it - but even for SAM I don't have a good control file.
I've asked someone here to set up this test using a known sequence- and if it works, I'll bundle the results into the Vancouver Package so everyone can use it.
Here's the 50-mer I picked to do the test. For those of you with some knowledge of cancer, it comes from tp53. It appears to blast uniquely to this location only.
I know Sam format should help with this - assuming everyone adopts it - but even for SAM I don't have a good control file.
I've asked someone here to set up this test using a known sequence- and if it works, I'll bundle the results into the Vancouver Package so everyone can use it.
Here's the 50-mer I picked to do the test. For those of you with some knowledge of cancer, it comes from tp53. It appears to blast uniquely to this location only.
>forward - chr17:7,519,148-7,519,197
CATGTGCTGTGACTGCTTGTAGATGGCCATGGCGCGGACGCGGGTGCCGG
>reverse - chr17:7,519,148-7,519,197
ccggcacccgcgtccgcgccatggccatctacaagcagtcacagcacatg
Labels: Aligners, application development, Bioinformatics, Code planning, Sequencing, short-reads, Vancouver Short Read Analysis Package

0 Comments:
Post a Comment
<< Home